BLAST#
BLAST, or the Basic Local Alignment Search Tool (BLAST), is the most commonly used alignment tool and, which you may be able to tell from its acronym, performs local alignment. The details of the algorithm (here) are beyond the scope of this course, but understanding the scoring system is important.
BLAST scores an alignment residue by residue based on whether it is a match, mismatch, or a gap (which might exist due to the insertion or deletion of 1 or more residues in one sequence).
mismatch
|
ATGACTAGCTGCTATATCAGCTAC
|| |||||||| ||||||| <-- every | indicates a match
GTG-CTAGCTGC-----CAGCTAC
| |
gap extended gap
The score for a match or mismatch depends on exactly which residues are being compared. For DNA (BLASTn) the default for is: +2/-3 for match/mismatch and -5 for gap opening and -2 for gap extension.
For amino acids this is more complex, where residues with similar properties (say, hydrophobicity or polarity) are penalised less than those that are very different. A scoring matrix is employed to determine the final match or mismatch score. A commonly used amino acid matrix, BLOSUM62:
Gaps are scored in two ways. Firstly, there is a penalty for opening a gap, and if there are multiple gaps in a row then a gap extension penalty is applied, typically less than the penalty for opening it in the first place. In BLAST, these penalties depend on the exact algorithm used.
So the final score for a given alignment is the sum across all residues of the matches, mismatches, gap openings and gap extensions.
If you are further interested in BLAST options and scoring you can have a look `here < https://www.ncbi.nlm.nih.gov/books/NBK279684/>`__.